Resources Molecular Markers CAPS CAPS Markers Chromosome 3


Chromosome 1- Chromosome 2 - Chromosome 3 - Chromosome 4 - Chromosome 5 - Physically mapped CAPS markers
Marker Chromosome #, map position Fragment size (kb) Enzymes: ecotypesb, # cuts (size of products in kb) Primers Reference or Source
CA1a 3, position 4.24 on RI map 1.408 DdeI: Col, 1 (0.869, 0.539); Ler, 2 (0.633, 0.539, 0.236). Note: Primer Tms, approx. 57.2 and 57.6 degrees C respectively. 5'-GGCTTCTTTCTCACTTCACTTTCTCC-3' 5'-AACCGTCTTTAGCTCTTCCTTCTCG-3' R. McClung, unpublished.
myb4a 3, position 4.73 on RI map 1.6 ? HaeIII: Col, 1 (1.0, 0.4); Ler, 1 (1.2, 0.4) 5'-GCCGGGTTGAAGAAAGGGCC-3' 5'-CCAAATGACAACGACGTTATC-3' D. Poole, unpublished
YUP4G12RE 3, btn nga32 and nga172 1.65 TaqI: Col, 1 (1.2, 0.45); Ler, 1 (1.3, 0.35) 5'-CAAACAAAATCAAATGACGG-3' 5'-CAGGCTGGGAATGTATGTTC-3' D. Poole, unpublished
17D8LE 3, btn nga32 and nga172 1.9 Hinc2: Col=Ws, 1; Ler, 2 5'-CTCCTTTGTCATCTCCCGAATC-3' 5'-CCAACAACATGCATGATAGTTCAG-3' Bartel, B. and Fink, G.R. (1995) Science, 268: 1745-1748
4G12RE 3, btn nga32 and nga172 1.1 DdeI: Col=Ler, 3; Ws, 2 5'-CAAACAAAATCAAATGACGG-3' 5'-CCCGAACCAATTCAATGATTC-3' Bartel, B. and Fink, G.R. (1995) Science, 268: 1745-1748
l16N 3, btn nga32 and nga172 2.2 Afl2: Col=Ler, 1; Ws, 0 5'-GCGTCTTC-GAGTAACTTTATC-3' 5'-GCGGGAAACGGAGAATTTGAAAC-3' Bartel, B. and Fink, G.R. (1995) Science, 268: 1745-1748
GAPCa 3, position 8.41 on RI map 1.148 EcoRV: Col=CV=  No-0=R, 1 (0.735, 0.713); Ler=C24=Ws, 2 (0.713, 0.39, 0.34) 5'-CTGTTATCGTTAGGATTCGG-3' 5'-ACGGAAAGACATTCCAGTC-3' The Plant J. (1993) 4, 403-410. T. Altmann (C24), C.A. Blanco (CV), H. Ichikawa (RLD), D. Wagner (No-O), unpublished.
LTI6Ba 3, position 9.6 on RI map 0.94 AluI: Col, 3 (0.34, 0.32, 0.25, 0.07); Ler, 3 (0.33, 0.32, 0.26, 0.07) 5'-ATACCGCATAATGCCCAAAG-3' 5'-GGAGAAGAGCACGACGAAAC-3' Thorlby et al, Plant J. (1999) 17, 445-452
S6 3, 150 kb centromeric of m583 0.85 Hinf1: Col, (major product: 0.29); Nd, (major product: 0.2) 5'-TTTTTCAACCTTTCCCCC-3' 5'-ACCACCAACAACAGATTTC-3' M. Grant, unpublished.
C6 3, about 300 kb telomeric to g4523 0.8 Dde1: Col, (major product: 0.45); Nd (major product: 0.65) 5'-GCCTACCATCAATAAACC-3' 5'-ATGAAAGACATCACAGATCC-3' M. Grant, unpublished
B4 3, aprx. 180 kb telomeric from g4523 0.9 TaqI: Col (major product: 0.55); Nd (major product:0.75) 5'-TGGTAGAAAATTTGGGATTG-3' 5'-GTCTTTTGTCATGCGCCTCC-3' M. Grant, unpublished
MNSODa 3, position 14.78 on RI map 1.23 TaiI (digestion@ 65 degrees C): Col, 2 (0.7, 0.3, 0.23); Ler, 1 (1.0, 0.23). Note: 1.5 mM MgCl2, 60 degrees C annealing temperature 5'TTACGCTTCCTGATCTTCCTTACG 3' 5'CTCCCAAACATCTATACCCACCAG 3' D. Kliebenstein,  unpublished
PK19a 3, position 15.8 on RI map 1.3 MboI: Col, 4 (0.45, 0.40, 0.15, 0.11, 0.10); Ler, 4 (0.45, 0.40, 0.16, 0.11, 0.10) 5'-TGCTGTTGTCTACAGTCGATCC-3' 5'-TTTGTGCATATTCATATGTTTCG-3' Thorlby et al, Plant J. (1999) 17, 445-452
ArLIM15 3, 10 cM south of nga162, 2 cM north of m255 0.5 EcoRI: Col=Ws, 1 (0.45, 0.05); Ler, 0 (0.5) 5'-GCCAGTTTTTTCCTGCACATCAATC-3' 5'-TGCTGCTTTATTTTGTCGCGATGTT-3' A. Diener, unpublished
ArLIM15 0.9 RsaI: Col, 2 (0.5, 0.3, 0.1); Ws, 1 (0.8, 0.1) 5'-ACCTTTGATTCCAGTAAGGTTCTG-3' 5'-CTCTTAGAGCGAGAAAATGATGGC-3' A. Diener, unpublished
m255 3, 2 cM south of ArLIM15, 2 cM north of ABI3 1 ScrFI: Col, 1 (2x 0.5); Ler, 0 (1.0) 5'-GTGTTTAGTAATGAATAATCATCAATC-3' 5'-AAGGGAAGTGGATTGGCTCCATGGC-3' A. Diener, unpublished
AtDMC1a 3, position 32.66 on RI map no cutting requiredATM1+ATM2 give Col, (2.2) and Ler, (0.342)ATM2+AR2 give Col, (0.446) and Ler, no fragment ATM1 5'-TTGATTAGTGGATCCGCAAACAA-3'ATM2 5'-GCAACTGAATTTGTTTTCGTTTG-3'AR2 5'-TAGATGAAACGAGTTTGACACATG-3' Klimyuk, VI and Jones, JDG. The Plant J. (1997) 11 (1): 1-14. 
32C9 100 kb south of m255 (36.31), on TAMU BAC 32C9 1 DdeI: Col, 2 (0.6, 0.3, 0.1); Ler=Ws, 1 (0.7, 0.1) 5'-AAGCTTTGAATGAGTGGAACCACAG-3' 5'-AAACTGTATCCACCACAACTCCGAG-3' A. Diener, unpublished.
Superman 3, 2 cM south of m255 0.9 NruI: Col, 0 (0.9); Ler, 1 (0.5, 0.4) 5' GTCAAGATATGGCTCACGAGGA 3' 5' GATCTATGGAGATGACACAAG 3' H. Sakai, unpublished
ABI3 3, 2 cM south of m255, 10 cM north of gl1 1.6 HinfI: Col, 2 (0.8, 0.7, 0.1); Ler=Ws, 1 (1.5, 0.1) 5'-CCACGTCAGCAGGTGGTACCAGATC-3' 5'-GGGCCTCCGGCTTTTGTCCGCTCGG-3' A. Diener, unpublished.
g4711a 3, position 38.06 on RI map 1.5 HindIII: Col, 0 (1.5); Ler, 1 (1.0, 0.5) 5'-ACCAAATCTTCGTGGGGCTCAGCAG-3' 5'-CCTGTGAAAAACGACGTGCAGTTTC-3' A. Diener,unpublished
GAPAa 3, position 43.77 on RI map 0.771 (L>C product, 10 bp) DdeI: Col, 5 (0.42, 0.178, 0.1, 0.033, 0.019, 0.01); Ler=C24=CV=No-0=R=Ws, 6 (0.24, 0.19, 0.178, 0.1, 0.033, 0.019, 0.01) 5'-CACCGTGATCTAAGGAGAGCAAG-3' 5'-TGTGCTCAACCAAACTTAGCC-3' The Plant J. (1993) 4, 403-410. T. Altmann (C24), C.A. Blanco (CV), H. Ichikawa (RLD), D. Wagner (No-O), unpublished.
GL1a 3, position 48.45 on RI map 0.519 TaqI: Col, 3 (0.298, 0.1, 0.074, 0.047); Ler=C24, 2 (0.372, 0.1, 0.047); CV=Nd=R, 1 (0.4, 0.12); HinfI: Ler, 1 (0.36, 0.16); Nd, 0 (0.52) 5'-ATATTGAGTACTGCCTTTAG-3' 5'-CCATGATCCGAAGAGACTAT-3' The Plant J. (1993) 4, 403-410. T. Altmann, (C24), C.A. Blanco (CV), H. Ichikawa (RLD), unpublished.
TOPP5a 3, position 59.20 on RI map 2 RsaI: Col=Ws=Nd, 2 (1.3, 0.6, 0.2); Ler, 3 (0.9, 0.6, 0.4, 0.2). Note: annealing temp. 52 degrees C, Mg2+ concentration= 2mM. 5'-TCGACGACATCATTCGTCGT-3' 5'-GAACTGAAGCATCCTGCAGT-3' R. McGrath, unpublished.
ALS 3, closely linked to m249 and m409 1.372 HaeIII: Col, 1 (0.952, 0.42); Ler=Ws=Nd, 2 (0.952, 0.22, 0.2); Rsa I: Col, 5 (0.384, 0.347, 0.267, 0.233, 0.109, 0.032); Ler=Ws=Nd, 4 (0.5, 0.384, 0.347, 0.109, 0.032). 5'-ATCACAGGACAAGTCCCTCG-3' 5'-GGCAACACATGTTCTTGGTG-3' R. McGrath, unpublished.
NIT1 3, btn GL1 and m249 Col=Nd, 1.8; Ler, 1.9 no cutting required 5'-GAATTCGGTTGTGATTCGTCAG-3' 5'-AGTACTAGACATATCAACTCG-3' PNAS(1994) 91, 6649-6653
NIT1 3, btn GL1 and m249 Col=0.85Ler=1.0 no cutting required 5'-CCCTACATTCTACAACCATGTAGCC-3' 5'-CGGAATTGATGTTTTGGACC-3' P. Berthomieu, unpublished.
XERO1a 3, position 72.4 on RI map 0.78 AluI: Col, 7 (0.27 and 7 smaller); Ler, 7 (0.28 and 7 smaller) 5'-CCTATCCAAAGTTGCGGTTC-3' 5'-TCTTCTCCATCATGCCTTTC-3' Thorlby et al, Plant J. (1999) 17, 445-452
F3Ha 3, position 72.75 on RI map 1 BclI: Col, 0 (1.1); Ler, 1 (0.4, 07) 5'ATTTCTCCACAGACCACAAG-3' 5'-TACTCCTCCGTCACTTTCAC-3' K. Butcher and G. Warren, unpublished
g19397 3, close to m457, 5.4 cM north of AP3 0.9 BsuRI: Col=Ler, 2 (0.55, 0.28, 0.07); Nd, 1 (0.55, 0.35). Note: Annealing temperature, 60 degrees C. 5'-CCGACAGTGGAATGCAGAGTTC-3'  5'-AGATGTAAGCAAGGCAAGCACC-3' K. Schrick, unpublished
prc6(a) 3, between Em and AFC1 (approx. 1.5 cM north of AFC1) + SstI: Col=Ws, 1 (0.6, 1.4); Ler, 0 (2.0) 5'-GAAAAAGGTAAAAGAATGGCGAG-3' 5'-ACGGTAAGTTACACAATGGAGA-3' J. Desplans and P. Berthomieu, unpublished.
AFC1a 3, position 73.94 on RI map 1.4 PvuII: Col,1 (0.8, 0.6); Ler, 0 (1.4) 5'-GGAACTCTCAAGTCTAAACAG-3' 5'-AGCTTTATCACGATACACACTGC-3' J. Bender, unpublished.
PUR5 3, ~ 4 cM north of BGL1 0.714 RsaI: Col=Ler, 3 (0.264, 0.26, 0.132, 0.037); Ws=Nd, 2 (0.524, 0.132, 0.037). Note: annealing temp. 50 degrees C. 5'-GATGTAGACCTTGCTGAAAA-3' 5'-AAACCTTTCACTCCTCCTTTTTC-3' R. McGrath, unpublished.
TT5 3, closely linked to BGL1 1.482 HindIII: Ler=Nd, 1 (0.89, 0.61); Ws, 2 (0.89, 0.35, 0.26). Note: annealing temp. 56 degrees C, Mg2+ concentration 2mM. 5'-GTGAATATCGAATCCTATCTC-3' 5'-CAGTATAGTTCACAACAAAC-3' R. McGrath, unpublished.
BGL1a 3, position 75.24 on RI map 1.269 RsaI: Col=Nd, 2 (0.785, 0.34, 0.105);  Ler=CV=No-0=R=Ws, 1 (0.785, 0.485); Sau3AI: Col, 0 (1.269); Ler=C24=CV=R=Ws, 1 (0.875, 0.395); AflIII: Col, 4 (0.494, 0.344, 0.258, 0.15, 0.084); Ler=CV=R, 3 (0.494, 0.434, 0.258, 0.084) 5'-TCTTCTCGGTCTATTCTTCG-3' 5'-TTATCACCATAACGTCTCCC-3' The Plant J. (1993) 4, 403-410. T. Altmann (C24), C.A. Blanco (CV), H. Ichikawa (RLD), D. Wagner (No-O), unpublished.
FUS6 3,  south of BGL1 1.559 AccI: Col=Ws, 3 (0.936, 0.228, 0.211, 0.185); Ler=Nd, 3 (0.936, 0.228, 0.211, ~0.2). Note: annealing temp. 50 degrees C, Mg2+ concentration 1.5 mM. 5'-CGGGTAATTGCGTTTTTGAC-3' 5'-GGAAGCCTTCATAATCGATAC-3' R. McGrath, unpublished.
AP3-La 3, position 76.69 on RI map 0.72 Sau3AI: Col=Nd=Ws, 1 (0.65); Ler, 0 (0.72) 5'-GCGTAAAGCGATAAGTGC-3' 5'-AGTGACGAACCACGATTCG-3'  K. Schrick, unpublished.
CDC2B 3, btn m457 and g2778 1.4 MseI: Col, 3; Ler=CV, 4; Tru1L: Col=Nd 5'-CGTCTGAAGGTCTGCACCTACTC-3' 5'-CGCTAAGATACTTCCACGTCAC-3' J. Celenza, C.A. Blanco (CV), unpublished.
CDC2A 3, btn g4014 and m457 2.5 AluI: Col=CV, 4; Ler, 3 5'-GAGAAGGGTGGTGGTTTTCTGTG-3' 5'-GGTGTAGTGGTTAGCACTCTGG-3' J. Celenza, C.A. Blanco (CV), unpublished.
TSA1a 3, position 92.04 on RI map 0.38 AluI: Col, 1 (0.246, 0.134); Ler, 0 (0.38) 5'-TCTTGGTAGCATGATTCTCAGTC-3' 5'-CCTTTCCGCTTACAGATGATC-3' Radwanski, E.R.; Barczak, A.J.; and Last, R.L. (1996) Mol. Gen. Genet. 253 (3): 353-361.
CP29 3, no map position 2.97 NdeI: Col, 4 (2.035, 0.557, 0.213, 0.152, 0.015); Ler, 3 (2.035, 0.77, 0.152, 0.015) 5'-TTCAATCCTAAATCCCTTCC-3' 5'-ACTGCAGCTGTAGTACTAAC-3' J. Nardone, unpublished
atpox 3, between GL1 and T25C10-sp6 798 CAPS (Msp I)C=4 fragments, L=5 fragments 5'-TCTGCTGCGGTGGGAATACAAAAG-3' 5'-GCCATCATTCCCCGGTTCTCATAAG-3' G. Copenhaver, M. Spielman & D. Preuss
T21P20-sp6 3, between T7K14-sp6 and T5M14-sp6 407 CAPS (Mse I)C=2 fragments, L=3 fragments 5'-CAAGCTTCATGGGGACTAG-3' 5'-TAATACGGGACAATCTACAACAC-3' G. Copenhaver & D. Preuss
ASD.1 3, between T5M14-sp6 and NIT1 458 CAPS (Nla III)C=4 fragments, L= 3 fragments 5'-ATGATCAAAGGGGGACGAGG-3' 5'-AAGGAAACACCACCAAACGAAAAC-3' G. Copenhaver & D. Preuss
aMarker mapped on RI lines (Lister and Dean, 1993).
bEcotypes: Col= Columbia, B=Bensheim, CV=Cvi, Ler=Landsberg erecta, Nd=Niederzenz, No-0=Nossen, R=RLD, Ws=Wassilenskija

Chromosome 1- Chromosome 2 - Chromosome 3 - Chromosome 4 - Chromosome 5 - Physically mapped CAPS markers