Resources Molecular Markers CAPS CAPS Markers Chromosome 5


Chromosome 1- Chromosome 2 - Chromosome 3 - Chromosome 4 - Chromosome 5 - Physically mapped CAPS markers
Marker Chromosome #, map position Fragment size (kb) Enzymes: ecotypesb, # cuts (size of products in kb) Primers Reference or Source
CTR1a 5, position 9.32 on RI map 3.348 BclI: Col=R, 3 (2.273, 0.701, 0.251, 0.123); Ler, 2 (2.273, 0.952, 0.123) 5' CGATCCTGCATCAGGTATTCC 3' 5' CTTACTTAGACGCGAAGGC 3' W. Liu and S.H. Howell, H. Ichikawa (RLD), unpublished.
PAI2 5, near ASA1 (110 kb) 0.644 AflIII: CV=Ws=Ler, 0 (0.644); Col, 1 (0.594, 0.05) 5'-CAGTTAATGAAACAAGCTTTGTTC-3' 5'-GTTGAGAAAATCACTTTGGTG-3' Cell (1995) 83, 725-734.
ASA1a 5, position 18.35 on RI map 1.728 BclI: Col=C24=CV, 1 (1.042, 0.686); Ler=R=Ws, 2 (0.686, 0.553, 0.489) 5'-CTTACTCCTGTTCTTGCTTAC-3' 5'-CCTCTAGCCTGAATAACAGAAC-3' The Plant J. (1993) 4, 403-410. T. Altmann (C24), C.A. Blanco (CV), H. Ichikawa (RLD), unpublished.
N97067a 5, position 20.61 on RI map 0.22 HinfI: Col, 1 (0.2, 0.02); Ler, 0 (0.22). Note: annealing temp. 48 degrees C. 5'-GGATTGCTGATACATTGC-3' 5'-GCCCATCACCACATTC-3' D. Hughes, unpublished.
PAT1 5, 8 cM centromere proximal from ASAI (approx. position 25.9 1.9 SphI: Col, 0 (1.9); Ler=CV=Ws, 1 (1.3, 0.6); DdeI: Col, 2 (1.0, 0.6, 0.3); Ler=CV=Ws, 1 (1.0, 0.9) 5'-GTCGACGTGGTGCGGTGGGTTG-3' 5'-GTATGAGAACATAGTAACCCCATG-3' Cell (1995) 83, 725-734.
PAT1 in both the unified and integrated maps, PAT1=pAR119) Col=0.706 bp, Ler=0.606 no cutting is required 5'-AGCTGAAGCTCTGCCACC-3' 5'-CATGCTTCATCATTGCCC-3 Alan Rose, unpublished
RCI1Ba 5, position 25.32 on RI map 1.8 MboI: Col: 7 (0.9, 0.35, 0.26, 0.15, etc); Ler, 7 (0.8, 0.35, 0.26, 0.15, etc) 5'-CAGCTCGTTACAGGCGCTAC-3' 5'-ATCGATTTGGTGGCAGAAAC-3' G. Warren, unpublished
CHS1a 5, position 29.53 on RI map 2.0 HphI: Col, 4; Ler, 3; SfaNI: Col, 4; Ler, 3 5'-CACGAGCCTGGAAGCTACTCTC-3' 5'-CTCTGAGCCTGTCTGATCTCATCC-3' John Celenza, unpublished
r89998a 5, position 38.65 on RI map 0.45 RsaI: Col, 2 (0.35, 0.07, 0.03), Ler, 1 (0.44, 0.01). Note: annealing temp. 50 degrees C. 5'-GCCAATCCCTAGAGCACTCA-3' 5'-GTAATTCCGGTCCCTCCAAC-3' D. Hughes, unpublished.
NIT4 5, north of m291 (2 cM) 1.9 AseI: Col=Ler, 1; Ws, 0; MboII: Ler=R=Ws, 4; Col, 5 5'-CGTTTCTTGTTGCATGGACATGAGAG-3' 5'-CAACTCCACATCCGTCGGCG-3' PNAS(1994) 91, 6649-6653. H. Ichikawa (RLD), unpublished.
PHYCa 5, position 71.13 on RI map 1.2 MspI: Col=Ws, 2; CV=Ler, 1; ScrFI: Col=R, 3; CV=Ler, 2 5'-CGCTTACTGAAAACTATAGCCGCG-3' 5'-GAAGACTTTCAAAAACACCACAC-3' Bonnie Bartel, H. Ichikawa (RLD), unpublished.
PHYCa 2.0 aprox. PstI, Col (1.7, pieces < 0.3); Ler, (0.8, 0.7, several pieces < 0.3); ClaI, ScrFI: polymorphic between Col and Ler 5'-CCTAATGGAGAATCATTCGG-3' 5'-CTACAGAATCGTCCTCAACG-3' Dan Poole, unpublished
RBCS-Ba 5, position 80.81 on RI map 1.152 SspI, Col 2 (0.609, 0.286, 0.257); Ler=C24=Ws=Be, 1 (0.866, 0.286) 5' -TATCGACAATTTATTGTGG -3' 5' -TGAATGGAGCGACCATGGTGGCCTGAGCCGG -3' Y. Niwa et al., DNA Research 4, 341-343 (1997)
DFRa 5, position 89.51 on RI map 1.143 BsaAI: Col=C24=CV=No-0=Ws, 1 (0.609, 0.534); Ler=R, 2 (0.609, 0.318, 0.216) 5'-AGATCCTGAGGTGAGTTTTTC-3' 5'-TGTTACATGGCTTCATACCA-3' The Plant J. (1993) 4, 403-410. T. Altmann (C24), C. Alonso Blanco (CV), H. Ichikawa (RLD), D. Wagner (No-O), unpublished.
DFRa TaqI: polymorphic between Col, Ler=C24 5'-AGATCCTGAGGTGAGTTTTTC-3' 5'-TGTTACATGGCTTCATACCA-3' T. Altmann, unpublished (C24)
CRA1 5, btn DFR and nga129 1.4 MseI: Col, 4; Ws, 3 5'-GCACATTAGGAGCGGTGATACCATTGC-3' 5'-GCATGACAATATTTTGGCGACTTGTC-3' John Celenza, unpublished
LTI78a 5, position 104.7 on RI map 0.86 RsaI: Col, 3 (0.37, 0.25, 0.11, 0.08); Ler, 3 (0.37, 0.25, 0.11, 0.09) 5'-TCTTCCGATTACACCAAACC-3' 5'-CTGATTCACTACCAAAGCCC-3' Thorlby et al, Plant J. (1999) 17, 445-452
PINHEAD 5, between nlp and ve027 0.91 EcoRI: Col, 0 (0.91); Ler, 1 (0.655, 0.255) 5'-CGTTGCTCGTGGATTTTGTAA-3' 5'-CTTGTATAAGTTCTTGCCTGTGA-3' k. Lynn, unpublished
ILL3 5, on TAC clone K18G13 (tightly linked to m435) 1.2 1 NdeI site in Col-0 and 2 NdeI sites in Ler or WS 5'-GTCAACAAAGTCAATTTTCCGATC-3' 5'-CAGAGAGCACATGGCTTAAGAGAGG-3' Davies, R.T., Goetz, D.H., Lasswell, J., Anderson, M.N., and Bartel, B. (1999) Plant Cell 11, 365-376.
ILL2 5, on PI clone MIK19 (between markers m435 and g2368) 2 3 HaeIII sites in Col-0 and 4 HaeIII sites in Ler or WS 5'-CTCAGTTTGACTTTCCAACTACTCCTTT-3' 5'-GCCAATACATTACAACAAGACCAATG-3' Davies, R.T., Goetz, D.H., Lasswell, J., Anderson, M.N., and Bartel, B. (1999) Plant Cell 11, 365-376.
ILL1 5, on PI clone MIK19 (between markers m435 and g2368) 1.3 3 TaqI sites in Col-0 or Ler and 4 TaqI sites in WS 5'-GCATGCTTGTGGACATGATGGTCA-3' 5'-TCGCAATTGAAATTGTTCTACGAA-3' Davies, R.T., Goetz, D.H., Lasswell, J., Anderson, M.N., and Bartel, B. (1999) Plant Cell 11, 365-376.
PLC1a 5, position 113.0 on RI map 1.7 HindIII: Col, 0 (1.7); Ler, 1 (1.6, 0.17) 5'-GAATCAGCCATTATCGCATTAC-3' 5'-GGGAACTCAAACTCCTTGTCC-3' Thorlby et al, Plant J. (1999) 17, 445-452
m558aa 5, position113.80 on RI map non-polymorph 0.7, polymorph 0.5 no cutting required; low+colup or +laup give Col or Ler alleles respectively; low+ up give a fragment for both ecotypes colup: 5'-TTTCTCGGTCTCCGATTAAC-3' laup: 5'-TTTCTCGGTCTCCGATTAAT-3' low: 5'-AAAGATAACCAAAGTCAGAGAT 3' up: 5'-ACCACGATAAAATAAAAACACG-3' Herman Hofte, unpublished
AtTED2a 5, position 115.3 on RI map 0.66 EcoRV :  Ler, 2  (0.35 0.23 0.08);   Col=WS, 1  (0.43  0.23) 5'-CGTAGACAAGGTACTGTCAACC-3' 5'-GATAATCTCGTCTCCAAGTGTCC-3' P. BERTHOMIEU, F. CARLAND, C. LAMBERT, unpublished.
17C2 5, 350 kb north of LFY 1.4 AccI: Col,1 (0.9, 0.5); Ler, 2 (0.9, 0.3, 0.2) 5'-CAATTGTTGTGTCTTGTGTGTG-3' 5'-GTTTCCTCGAACTCGAATGTAAC-3' Judith Bender, unpublished
10A10 5, 250 kb north of LFY 2.0 HphI: Col, 3 (1.3, 0.31, 0.29, 0.1); Ler, 4 (0.8, 0.5, 0.31, 0.29, 0.1); BstEII: Col, 0 (2.0); Ler, 1 (1.3, 0.7) 5'-GCCTTATGGATTTTCTGGAGAAAG-3' 5'-GGTCACAGGGATCAAGATGTGG-3' Judith Bender, unpublished
EG7F2 5, 1 cM north of LFY 1.2 XbaI: Col,0 (1.2); CV=Ler, 1 (0.7, 0.5); BsaBI: Col=CV, 1 (0.9, 0.3); Ler, 0 (1.2) 5'-GATCTGTGTAGGACTACGAGAC-3' 5'-GCATAGAATTTGACGATAACGAGC-3' Judith Bender, unpublished
ASB2 5, near LFY, north of cer3 1.3 HinfI: Col, 3; CV=Ler, 4 5'-GAAGATCTTGTTGTAACATAGC-3' 5'-GGTATCGAATTCGATTCC-3' The Plant Cell(1993) 5: 1011-1027.
LFYa 5, position 116.88 on RI map 1.33 RsaI: Col, 5 (0.708, 0.236, 0.147, 0.126, 0.078, 0.035); Ler=C24=CV=No-0=R=Ws, 4 (0.855, 0.236, 0.126, 0.078, 0.035) 5'-TAACTTATCGGGCTTCTGC-3' 5'-GACGGCGTCTAGAAGATTC-3' The Plant J. (1993) 4, 403-410. T. Altmann (C24), C.A. Blanco (CV), H. Ichikawa (RLD), D. Wagner (No-O), unpublished.
LIU3 5, 0.2 cM south of LEAFY 0.9 TaqI: Ws, 2 (0.503, 0.259, 0.138); Ler, 2 (0.503, 0.259, 0.145). Note: annealing temp. 48 degrees C. 5'-CATGTTGGGAATTTGCAGTC-3' 5'-CATGTTTCCAGAGATACCAA-3' C. Liu, unpublished
g2368a 5, position 125.12 on RI map 1.4 HindIII: Col=CV,0 (1.4); Ler, 1 (1.35, 0.05) 5'-AAGCTTTTGAATAGGACAGCATTG-3' 5'-CGTTTTCATTGGTCCACTGCATGG-3' Judith Bender, C.A. Blanco (CV), unpublished.
RAB18a 5, position 128.7 on RI map 0.66 AluI: Col, 3 (0.25, 0.21, 0.10, 0.08), Ler, 4 (0.21, 0.20, 0.10, 0.08, 0.04) 5'-GGCGTTTGGTAAAAGTTGAG-3' 5'-GTTTCCGTACTCGTCAGTGG-3' Thorlby et al, Plant J. (1999) 17, 445-452
m555a 5, position 132.60 on RI map 0.15 AccI: Col, 0 (0.15); Ler=Ws, 1 (0.1, 0.05) 5'-CTCTTGAATTATTAAGTTGACTAG-3' 5'-CCTTTAATTAGTTATCAAATC-3' J. Bender, unpublished. K. Kovac (Ler)
T18F2-sp6 5, between NIT4 and T14O24-sp6 542 Mse IC=4 fragments, L=5 fragments 5'-AGCTTCGATAACAAACTCACC-3' 5'-AGAAGATAAATCAACTAAACAAAATG-3' G. Copenhaver & D. Preuss
T14O24-sp6 5, between T18F2-sp6 and CUE1 430 CAPS (Tsp509 I)C=6 fragments, L=5 fragments 5'-TAGGACGCAAATCAGAGAAG-3' 5'-TACTAATCATGTGTCTTTAGGCTATC-3' G. Copenhaver & D. Preuss
CUE1 5, between T14O24-sp6 and T17M11-sp6 356 CAPS (Mse I)C=3 fragments, L=2 fragments 5'-TCTCGTTCTGATGGCTCCTGTG-3' 5'-GTGTAACCGGTGATACTCTCGCC-3' G. Copenhaver & D. Preuss
T2L5.3 5, between F18G23-t7 and T3L6-sp6 692 CAPS (Fnu4H I)C=uncut, L=2 fragments 5'-GCTGCGAAGGCTGAATGAAG-3' 5'-TCGCCGGGAAAAACAGTAAC-3' G. Copenhaver & D. Preuss
T3L6-sp6 5, between T2L5.3 and PhyC 489 CAPS (Mnl I) C=2 fragments, L= uncut 5'-GAGCGTGCTTTTGGAGTTTTG-3' 5'-AACCCTAGATCGCCCTTTTTTC-3' G. Copenhaver & D. Preuss
aMarker mapped on RI lines (Lister and Dean, 1993).
bEcotypes: Col= Columbia, B=Bensheim, CV=Cvi, Ler=Landsberg erecta, Nd=Niederzenz, No-0=Nossen, R=RLD, Ws=Wassilenskija

Chromosome 1- Chromosome 2 - Chromosome 3 - Chromosome 4 - Chromosome 5 - Physically mapped CAPS markers