Resources Molecular Markers CAPS CAPS Markers Physically mapped CAPS markers


Chromosome 1- Chromosome 2 - Chromosome 3 - Chromosome 4 - Chromosome 5 - Physically mapped CAPS markers
Marker Position Polymorphism Enzyme Primer Seq.
CM4-3 ATFCA0 5,000 No-o=Col-o: La-er. BglII gatcaataataagtgtcttctc
ttctgggttcttggtgatctc
CM4-6
(60C)
ATFCA0
10,000
No-o=La-er: Col-o BsmAI cggtgagggtcaaaatcgtct
aggaattctacgaggcgactcaa
FCA11 ATFCA1
42,000
No-o=La-er: Col-o
No-o=Col-o: La-er.
DraI
AccI, BclI
cggtatctccaggtgcgagac
gaggacaaacataactactgatac
FCA21
ATFCA2
71,000
No-o: La-er=Col-o
BstUI
cttcggttaattcacattcagg
ccttcatttcatgcacatatc
FCA22
ATFCA2
150,000
No-o=La-er: Col-o
No-o=Col-o: La-er.
SspI
BsmI
gcgtcatgacacaacgaatg
gtttactttggtaacataagtgg
FCA23
ATFCA2
167,000
No-o: La-er=Col-o
StyI
taaagtacatcgtcacgtatc
agttctatcgagattataacttc
FCA2B
ATFCA2
180,000
No-o=La-er: Col-o
BsrDI
attggggtgaaccatcactccc
cgtaggtttagattggcgagaagc
FCA2-190
ATFCA2
190,000
No-o=Col-o: La-er.
DdeI
ttcctacacactcactactcag
ttcgtatattgactagtggatg
FCA34
ATFCA3
7,000
No-o=Col-o: La-er.
ApoI
gaataaacagtgtcacatcc
tgaactaatttgcctgcag
FCA35
ATFCA3
15,000
No-o=La-er: Col-o SspI
tgttaagtaccatgttcactc
cttggcttctcttctgtatc
FCA3B
ATFCA3
30,000
No-o=La-er: Col-o TaqI ccgccatgcagaaaagctccgaacgc
ctgaaaccgatttgaaggtcgacgg
FCA38
ATFCA3
80,000
No-o=La-er: Col-o DraI
ttccagactcgcatgttgag
taacaatggtagaaaccataac
FCA3E
ATFCA3
90,000
No-o=La-er: Col-o DraI cggtgactctctaaccgtatctgccg
gagtttacttgtgggaacaacagtag
FCA391 ATFCA3
155,000
No-o=La-er: Col-o SspI cacatattatgtatgatagttgaag
gctttaaaccacctaaatcag
FCA312 ATFCA3
180,000
No-o=La-er: Col-o EcoRI atctcaaaccatcattatccag
tcaagaaagacaattcagctac
FCA461 ATFCA4
106,000
No-o: La-er=Col-o BstUI gatatggatcttagaacaactc
atgtgttgacaaacaatgtgc
Protocol is 0.1mg each primer, 50ml reaction volume.40 cycles, 94C 30" denaturing,
55C (except where stated otherwise) annealing (30"), extension at 72C for 2'30".

CAPS- Chromosome 1- Chromosome 2 - Chromosome 3 - Chromosome 4 - Chromosome 5 - Physically mapped CAPS markers